Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor.

By Hongwei Guo, Joseph R. Ecker. Cell, 2003

885 citations recorded by the source corpus.

View Paper: https://www.semanticscholar.org/paper/6fd653651d0c2f917d5f1b78c5204ae6bd084265

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Plant Science

Citations in the corpus

Jasmonate‐regulated Arabidopsis stress signalling network (2005, background): “…the identified F-box proteins have been functionally characterized (Gray et al. 1999; Samach et al. 1999; Dieterle et al. 2001; Woo et al. 2001; Devoto et al. 2002; Xu et al. 2002; Guo and Ecker 2003; Harmon and Kay 2003; Potuschak et al. 2003; Dill et al. 2004; Fu et al. 2004; Gagne et al. 2004).”
Understanding Root Rot Disease in Agricultural Crops (2020, background): “F-box proteins are known to be involved in hormone regulation and in plant immunity [353,354], regulation of pericycle cell divisions [355], and lateral root production [356].”
Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, background): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
Modulation of Plant Defenses by Ethylene (2007, background): “Thus, EBFs’ interaction with EIN/EIL proteins leads to their ubiquitination and subsequent degradation by the 26S proteasome pathway (Potuschak and others 2003; Guo and Ecker 2003).”
F-Box Proteins in Rice. Genome-Wide Analysis, Classification, Temporal and Spatial Gene Expression during Panicle and Seed Development, and Regulation by Light and Abiotic Stress1[W][OA] (2007, background): “The role of F-box proteins in ethylene (EBF1 and EBF2) and gibberellic acid (SLY1 and SNE) signaling has also been established (Guo and Ecker, 2003; McGinnis et al., 2003; Potuschak et al., 2003; Dill et al., 2004; Gagne et al., 2004; Strader et al., 2004).”
The Ubiquitin-Proteasome Pathway and Plant Development (2004, background): “(Guo and Ecker, 2003; Potuschak et al., 2003; Gagne et al., 2004) (Figure 3D).”
Antagonistic Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways Modulates Defense Gene Expression and Disease Resistance in Arabidopsis (2004, background): “, 2002), and recent studies showed that EIN3 is degraded, in the absence of ethylene, by protein ubiquitination (Guo and Ecker, 2003; Potuschak et al., 2003).”
A miRNA involved in phosphate-starvation response in Arabidopsis. (2005, background): “Alternatively, the UBC may be involved in the ubiquitination pathways for ethylene [12] or auxin [13] signaling because these two hormones control plant root architecture, and plant sensitivity to them has been shown to be modulated by Pi starvation [14, 15].”
Signaling mechanisms in pattern-triggered immunity (PTI). (2015, background): “These proteins are the transcription factor EIN3 (Guo and Ecker, 2003; Yoo et al., 2008), the nitrate reductase NIA2 (Wang et al.”
Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. (2011, background): “EIN3 itself is a short-lived transcription factor that is stabilized by ET and accumulates in nuclei after increases in ET (61, 72).”