Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.

By A. Schäfer, A. Tauch, W. Jäger, Jörn Kalinowski, G. Thierbach, Alfred Pühler. 1994

Citations in the corpus

• Global mapping of transcription start sites and promoter motifs in the symbiotic α-proteobacterium Sinorhizobium meliloti 1021 (2013, unknown): “To repair expR , the corresponding genomic sequence of strain Rm8530 [89] was amplified using primers 5 0 - ACACAAGCTTCTTCTGAACGGCGTATTCACA and 5 0 -TGATGAATTCCATTCCGTCGGCGAGATAGT and cloned into the Hind III and Eco RI restriction sites of pK18mobsac [90].”