Erratum: Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat (Molecular Genetics and Genomics 273:1 (54-65) DOI: org/10.1007/s00438-004-1095-4)

By D. Fu, P. Szűcs, Liuling Yan, M. Helguera, J. S. Skinner, J. Zitzewitz, P. Hayes, J. Dubcovsky. 2005

118 citations recorded by the source corpus.

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

Allelic Variation at the Vernalization Genes Vrn‐A1, Vrn‐B1, Vrn‐D1, and Vrn‐B3 in Chinese Wheat Cultivars and Their Association with Growth Habit (2008, background): “…TCATCCATCATCAAGGCAAA 1068 58 1 min 5 s Fu et al., 2005 Vrn-B1 Vrn-B1 Intr1/B/F Intr1/B/R3 CAAGTGGAACGGTTAGGACA CTCATGCCAAAAATTGAAGATGA 709 63 43 s Fu et al., 2005 vrn-B1 Intr1/B/F Intr1/B/R4 CAAGTGGAACGGTTAGGACA CAAATGAAAAGGAATGAGAGCA 1149 58 1 min 9 s Fu et al., 2005 Vrn-D1 Vrn-D1 Intr1/D/F…”
A Pseudo-Response Regulator is misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.) (2007, background): “The mechanism by which the deletion causes misexpression could be by removal of regulatory elements, as previously shown for mutations conferring spring growth habit in the Vrn1 gene (Yan et al. 2003; Fu et al. 2005), and/or the alteration of the transcription start site.”
Evaluation of Genetic Diversity and Genome‐wide Linkage Disequilibrium among U.S. Wheat (Triticum aestivum L.) Germplasm Representing Different Market Classes (2007, background): “This might be related to the fact that spring growth habit can be conferred independently by mutations in any of the three copies of the Vrn-1 gene ( Vrn-A1 , Vrn-B1 , or Vrn-D1 ; Yan et al., 2004; Fu et al., 2005) relaxing the selection pressure.”