Multiplex-PCR typing of high molecular weight glutenin alleles in wheat
By Wujun Ma, Wensheng Zhang, Kevin Gale. Euphytica, 2003
150 citations recorded by the source corpus.
Subfields: Molecular Biology, Plant Science
View Paper: https://www.semanticscholar.org/paper/3cdc0c647798ce64ecfaee994acba8215175ca53
How researchers see this paper
The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.
In Molecular Biology
In Plant Science
- J. Crouch
- D. Bonnett
- G. Rebetzke
- Scott C. Chapman
- Xianchun Xia
- Zhonghu He
- Jiankang Wang
- Tariq Mahmood
Citations in the corpus
- Characterization of CIMMYT bread wheats for high- and low-molecular weight glutenin subunits and other quality-related genes with SDS-PAGE, RP-HPLC and molecular markers (2010, methodology): “…used in the study Marker/gene Forward and reverse primers (50-30) Allele Fragment size (bp) References Ax2* F: ATGACTAAGCGGTTGGTTCTT Glu-Ax2* 1319 Ma et al. (2003) R: ACCTTGCTCCCCTTGTCTTT ZSBy8F5/R5 F:TTAGCGCTAAGTGCCGTCT Glu-By8 527 Lei et al. (2006) R:TTGTCCTATTTGCTGCCCTT ZSBy9aF1/R3…”
- Molecular characterization and marker development for hexaploid wheat-specific HMW glutenin subunit 1By18 gene (2015, background): “Thus far, many AS-PCR markers have been developed for different HMW-GS genes, including Glu-A1 (1Ax2*, 1Ax1 and 1Ax) (Smith et al. 1994; Ma et al. 2003; Liu et al. 2008), Glu-B1 (1Bx6, 1Bx7, 1Bx7OE, 1By8, 1By9, 1Bx14, 1By16, 1Bx17 and 1Bx20) (Ahmad 2000; Butow et al. 2003; Xu et al. 2008; Schwarz…”
- Application of population genetic theory and simulation models to efficiently pyramid multiple genes via marker-assisted selection (2007, background): “Except for Cre1 and VPM, the molecular markers are codominant (Korzun et al., 1998; Ogbonnaya et al., 2001; Ellis et al., 2002; Ma et al., 2003; Spielmeyer et al., 2003; Zhang et al., 2004).”
- Strategies for efficient implementation of molecular markers in wheat breeding (2004, background): “The RhtD1, Rht8, Sr2, Glu-B1 and Glu-A3 molecular markers are codominant, and Cre1, VPM and Glu-D1d markers dominant in genic expression (Korzun et al. 1998; Ogbonnaya et al. 2001; Ellis et al. 2002; Ma et al. 2003; Spielmeyer et al. 2003; Zhang et al. 2004).”
- Wheat seed storage proteins: Advances in molecular genetics, diversity and breeding applications (2014, background): “, 1Ax2*, 1Ax1 and 1Ax Null (Ma et al., 2003; Liu et al., 2008).”
- Marker assisted selection in crop plants (2005, unknown): “These properties depend on the endosperm gluten proteins, which comprise two major fractions: gliadins and glutenins (Ma et al., 2003).”