Clathrin-mediated endocytosis in AP-2–depleted cells

By A. Motley, N. Bright, M. Seaman, M. Robinson. Journal of Cell Biology, 2003

745 citations recorded by the source corpus.

We have used RNA interference to knock down the AP-2 μ2 subunit and clathrin heavy chain to undetectable levels in HeLaM cells. Clathrin-coated pits associated with the plasma membrane were still present in the AP-2–depleted cells, but they were 12-fold less abundant than in control cells. No clathrin-coated pits or vesicles could be detected in the clathrin-depleted cells, and post-Golgi membrane compartments were swollen. Receptor-mediated endocytosis of transferrin was severely inhibited in both clathrin- and AP-2–depleted cells. Endocytosis of EGF, and of an LDL receptor chimera, were also inhibited in the clathrin-depleted cells; however, both were internalized as efficiently in the AP-2–depleted cells as in control cells. These results indicate that AP-2 is not essential for clathrin-coated vesicle formation at the plasma membrane, but that it is one of several endocytic adaptors required for the uptake of certain cargo proteins including the transferrin receptor. Uptake of the EGF and LDL receptors may be facilitated by alternative adaptors.

Subfields: Cell Biology, Molecular Biology

View Paper: https://www.semanticscholar.org/paper/22b5018cdea63c3dc3b0d0027bc485c2bf600206

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Cell Biology

1. Emmanuel Boucrot
2. A. Sorkin
3. H. McMahon
4. M. Robinson
5. T. Balla

In Molecular Biology

1. Emmanuel Boucrot
2. A. Sorkin
3. H. McMahon
4. M. Robinson
5. Marcus J. Taylor
6. T. Balla

Citations in the corpus

• Functional Analysis of AP-2 α and μ2 Subunits (2006, methodology): “We have previously shown that depleting AP-2 reduces the number of coated pits by 12-fold (Motley et al., 2003), and although we found that EGF was still internalized with normal kinetics in these cells, Huang et al. (2004) subsequently showed that the rate of EGF uptake in AP-2–depleted cells…”
• Endocytosis and intracellular trafficking of ErbBs (2008, background): “Furthermore, under certain experimental conditions, depletion of AP-2 by siRNA did not affect EGFR internalization, although there is disagreement among different reports regarding the effect of AP-2 depletion on EGFR endocytosis [30,33,34].”
• Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal synapses. (2006, positive): “Both these manipulations have been characterized as effective methods of inhibiting CME in cell lines without causing apoptosis or cell death (Ford et al., 2001; Motley et al., 2003; Royle et al., 2005).”
• Hepatitis C Virus Entry Depends on Clathrin-Mediated Endocytosis (2006, background): “The CHC target sequence was UAAUCCAAUUCGAAGACCAAU ( 34 ).”
• Molecular mechanism and physiological functions of clathrin-mediated endocytosis (2011, background): “If maturation of the complex by recruitment of AP2 is prevented, then the nucleation complex is still assembled but clathrin is not recruited and vesicles do not for”