The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses[C][W]

By Patricia Fernández-Calvo, Andrea Chini, Gemma Fernández-Barbero, J. Chico, Selena Gimenez-Ibañez, J. Geerinck, D. Eeckhout, Fabian Schweizer, Marta Godoy, J. Franco-Zorrilla and 8 more. The Plant Cell, 2011

1,054 citations recorded by the source corpus.

This work identifies two transcription factors, MYC3 and MYC4, as targets of JAZ repressors and regulators of responses to jasmonate. It finds a specificity of transcription factor activity that could be a clue to understanding the diversity of JA-regulated responses. Jasmonates (JAs) trigger an important transcriptional reprogramming of plant cells to modulate both basal development and stress responses. In spite of the importance of transcriptional regulation, only one transcription factor (TF), the Arabidopsis thaliana basic helix-loop-helix MYC2, has been described so far as a direct target of JAZ repressors. By means of yeast two-hybrid screening and tandem affinity purification strategies, we identified two previously unknown targets of JAZ repressors, the TFs MYC3 and MYC4, phylogenetically closely related to MYC2. We show that MYC3 and MYC4 interact in vitro and in vivo with JAZ repressors and also form homo- and heterodimers with MYC2 and among themselves. They both are nuclear proteins that bind DNA with sequence specificity similar to that of MYC2. Loss-of-function mutations in any of these two TFs impair full responsiveness to JA and enhance the JA insensitivity of myc2 mutants. Moreover, the triple mutant myc2 myc3 myc4 is as impaired as coi1-1 in the activation of several, but not all, JA-mediated responses such as the defense against bacterial pathogens and insect herbivory. Our results show that MYC3 and MYC4 are activators of JA-regulated programs that act additively with MYC2 to regulate specifically different subsets of the JA-dependent transcriptional response.

Subfields: Insect Science, Plant Science

View Paper: https://www.semanticscholar.org/paper/15aad372d18b4ac7484c6a31015adf8f7c9f97de

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Insect Science

In Plant Science

Citations in the corpus

Jasmonic Acid Signaling Pathway in Plants (2019, background): “showed that MYB51 and MYB34 regulate the synthesis of tryptophan and glucosinolates and act downstream of MYC2 [45].”
Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis (2011, background): “Yeast two-hybrid pGADT7 EIN3 (1-300) BamH1 EIN3-1 CGGGATCCTCATGATGTTTAATGAGATG”
Signaling mechanisms in pattern-triggered immunity (PTI). (2015, background): “, 2002) and JAZ proteins repress MYC2, MYC3 and MYC4, key transcriptional activators of JA responses, by directly interacting with them (Chini et al., 2007; Fernandez-Calvo et al., 2011).”
Jasmonates: biosynthesis, metabolism, and signaling by proteins activating and repressing transcription (2016, background): “MYC2 contains an N-terminal JAZ interaction domain (JID) that interacts with JAZs (Fernández-Calvo et al., 2011), a transcription activation domain (TAD) required for transactivation and interaction with MEDIATOR25 (MED25) (Chen et al.”
The JAZ Proteins: A Crucial Interface in the Jasmonate Signaling Cascade (2011, background): “Fernández-Calvo, P., et al. (2011). The Arabidopsis bHLH transcription”
Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. (2013, methodology): “Homologous proteins of MYC2 were picked up independently in three groups by yeast-two-hybrid screening using JAZ as bait (Cheng et al., 2011; Fernández-Calvo et al., 2011; Niu et al., 2011).”
DNA-binding specificities of plant transcription factors and their potential to define target genes (2014, methodology): “We also included data relating previously characterized proteins (8, 10, 41).”