Phylogeny of the order Zoantharia (Anthozoa, Hexacorallia) based on the mitochondrial ribosomal genes

By F. Sinniger, J. Montoya-Burgos, P. Chevaldonné, J. Pawłowski. 2005

150 citations recorded by the source corpus.

Subfields: Ecology, Nature and Landscape Conservation, Oceanography

View Paper: https://www.semanticscholar.org/paper/02aa36e4284c6cf36c451befbb9fe8625f2c0aaa

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Ecology

1. J. Pawłowski
2. Michael N. Dawson
3. J. Stake
4. D. Fautin
5. Jennifer E. Purcell
6. J. Waters
7. Brian W. Bowen
8. J. C. Briggs

In Nature and Landscape Conservation

1. Michael N. Dawson
2. J. Stake
3. D. Fautin

In Oceanography

1. P. Cartwright
2. J. Pawłowski
3. Michael N. Dawson
4. A. Collins
5. D. Fautin
6. J. Waters
7. Brian W. Bowen
8. J. C. Briggs

Citations in the corpus

• The Parazoanthidae (Hexacorallia: Zoantharia) DNA taxonomy: description of two new genera (2010, methodology): “Specimens were then amplified for COI, mt 16S rDNA and ITS rDNA region using standard Taq polymerase and the primers LCOant: 5' TTTTCYACTAATCATAAAGATAT 3', COIantr: 5' GCCCACACAATAAAGCCCAATAYYCCAAT 3', 16Sant0a: 5' GAAGTAGGCTTGGAGCCAGCCA 3' as well as primers described in Folmer et al. (1994), Sinn”
• The phylum Cnidaria: A review of phylogenetic patterns and diversity 300 years after Linnaeus (2007, background): “Sphenopidae Hertwig, 1882 comprises three genera.”