Characterization of microsatellite loci in chinook salmon ( Oncorhynchus tshawytscha ) and cross-species amplification in other salmonids

By K. Williamson, J. F. Cordes, B. May. 2001

177 citations recorded by the source corpus.

Subfields: Ecology, Genetics, Nature and Landscape Conservation

View Paper: https://www.semanticscholar.org/paper/01468463b942d4293d6e07a9243c4fb3db3a6b81

How researchers see this paper

The researchers whose trusted networks rank it highest, strongest advocate first. Every researcher gets a different order.

In Genetics

1. Zhanjiang Liu
2. J. F. Cordes

Citations in the corpus

• Population structure and genetic diversity of trout (Oncorhynchus mykiss) above and below natural and man-made barriers in the Russian River, California (2007, unknown): “OtsG3 a,b O. tshawytscha Williamson et al. (2002) F: GGACAGGAGCGTCTGCTAAATGACTG 56 16 1,810 158‐258”
• DNA marker technologies and their applications in aquaculture genetics. (2004, background): “, 2001), chinook salmon (Williamson et al., 2001; Naish and Park, 2002), rainbow trout (Rexroad et al.”